View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12523_low_13 (Length: 227)
Name: NF12523_low_13
Description: NF12523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12523_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 34939625 - 34939414
Alignment:
| Q |
1 |
aaatgaagaaagtcaatggaaggggagaggccnnnnnnn-tgcatagaacttggtgcttgcttagtatatagaaaatgtttgttacaaatttcagagcca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34939625 |
aaatgaagaaagtcaatggaaggggagaggccaaaaaatatgcatagaacttggtgcttgcttagtatatagaaaatgtttgttacaaatttcagagcca |
34939526 |
T |
 |
| Q |
100 |
agnnnnnnngtttgctaaggaaaaatacactaaactttaggctctttaggcagagacaaacactagcaacagtgaaagaaaacaaaacaactgagagaag |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34939525 |
agtttttttgtttgctaaggaaaaatacactaaactttaggctctttaggcagagacaaacactagcaacagtgaaagaaaacaaaacaactgagagaag |
34939426 |
T |
 |
| Q |
200 |
gaaagagaagga |
211 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
34939425 |
gaaagaaaagga |
34939414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University