View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12523_low_16 (Length: 211)
Name: NF12523_low_16
Description: NF12523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12523_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 99
Target Start/End: Original strand, 47140196 - 47140278
Alignment:
| Q |
17 |
attatgattactttgtttctgtataaaaaatcgtttttaggaaatactgcaatgttaatttataaacttcaggttcaagatgt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47140196 |
attatgattactttgtttctgtataaaaaatcgttttaaggaaataatgcaatgttaatttataaacttcaggttcaagatgt |
47140278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 47140299 - 47140367
Alignment:
| Q |
128 |
ttaggtcatactcatacagaatgcaataagaccaataaaggatggatacgatctgtagaaagctttcat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47140299 |
ttaggtcatactcatacagaatgcaataagaccaataaaggatggatacgatctgtagaaagctttcat |
47140367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University