View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12523_low_7 (Length: 361)
Name: NF12523_low_7
Description: NF12523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12523_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 3425934 - 3425768
Alignment:
| Q |
16 |
ggaacaaccactcaaatccagtgttcgactcctacaatttcatgactaacttggggattgcttcaataataaagtagtataatggtcaataggttaaaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3425934 |
ggaacaaccactcaaatccagtgttcgactcctacaatttcatgactaacttggggattgcttcaataataaagtagcataatggtcaataggttaaaag |
3425835 |
T |
|
| Q |
116 |
agtgaatcacttatattcattaaaaaatttgagagccatcaatttagtctctgaaattctttgttgt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425834 |
agtgaatcacttatattcattaaaaaatttgagagccatcaatttagtctctgaaattctttgttgt |
3425768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 297 - 354
Target Start/End: Complemental strand, 3425653 - 3425596
Alignment:
| Q |
297 |
aaggatggacagtgagaatttttgcacagaaatagagtaaggaaggagaacaatgatg |
354 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
3425653 |
aaggatggacagtgcaaacttttgcacagaaatagagcaaggatggagaacaatgatg |
3425596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University