View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12524_high_4 (Length: 337)
Name: NF12524_high_4
Description: NF12524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12524_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 33338042 - 33338349
Alignment:
| Q |
1 |
cttgaatgatagtgcaactgtaggggactactgaaatttgaatgtaaaaaaccctagtttttcttcttatctttacctgtttcttatcccattatataag |
100 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
33338042 |
cttgaacgatagtgcaacggtaggggactactgaaatttgaatgtaagaaaccctagtttttcttcttatctttacctgtttcttatcccattatgtagg |
33338141 |
T |
|
| Q |
101 |
tgtttatatttggttagggatgatgaacctttgttagattcttgtgcaagtatgactcacattgcttcaatactagttttattcatgcttattgagtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338142 |
tgtttatatttggttagggatgatgaacctttgttagattcttgtgtaagtatgactcacattgcttcaatactagttttattcatgcttattgagtaat |
33338241 |
T |
|
| Q |
201 |
tacttctatgtttaatgctttacattgattgactatctttaaatttaatgtagattcaatctcacaattggaatacgaagttgattgcagtgctcgtgat |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33338242 |
tacttctatgtttaatgcttttcattgattgactatctttaaatttaatgtagattcaatctcacaattggaatacgaagttgattgccatgctcgtgat |
33338341 |
T |
|
| Q |
301 |
gatcctag |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
33338342 |
gatcctag |
33338349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 262 - 308
Target Start/End: Original strand, 33338374 - 33338420
Alignment:
| Q |
262 |
tcacaattggaatacgaagttgattgcagtgctcgtgatgatcctag |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338374 |
tcacaattggaatacgaagttgattgcagtgctcgtgatgatcctag |
33338420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University