View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12524_high_8 (Length: 311)
Name: NF12524_high_8
Description: NF12524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12524_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 30 - 311
Target Start/End: Complemental strand, 40183167 - 40182886
Alignment:
| Q |
30 |
aatatgaccctgcccatggtgttgaaatatttccaactacacttccaacattaactatggttccacnnnnnnncagagccatgtgaggcacaacttgttg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40183167 |
aatatgaccctgcccatggtgttgaaatattcccaactacacttccaacattaactatggttccactttttttcagagccatgtgaggcacaacttgttg |
40183068 |
T |
 |
| Q |
130 |
caccattcttagttgtcccaacgtgttaatttccaatgtttttctaatagtgtctagtggtaattcggctaatggacccgtgctacctattccggcgtta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40183067 |
caccattcttagttgtcccaacgtgttaatttccaatgtttttctaatagtgtctagtggtaattcggctaatggacctgtgctacctattccggcgtta |
40182968 |
T |
 |
| Q |
230 |
ttaactagaatgtcgatacgtccgtattttgatataatagtgtccacggctgaagtagcgctttgatcagatgaaacgtcaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182967 |
ttaactagaatgtcgatacgtccgtattttgatataatagtgtccacggctgaagtagcgctttgatcagatgaaacgtcaa |
40182886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University