View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12525_high_10 (Length: 231)
Name: NF12525_high_10
Description: NF12525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12525_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 11063558 - 11063734
Alignment:
| Q |
19 |
atcatatatgaactttttacatataatccttgcttatgtgaaatcaaatggactgttgtacatttaagctaatgaagcacgaacacctctaggattgggc |
118 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
11063558 |
atcatataagaaccttttacatataatccttgcttatgtgaaatcaaatggactgttatacatttaagctaattaagcacgaaaacctctaggattgggc |
11063657 |
T |
 |
| Q |
119 |
gtgtctgacacacgtcagtgttgaactctcgtatgacacttgtcacacacgtgtcggacaactaaaacgagtgtccc |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| || |||||||| |
|
|
| T |
11063658 |
gtgtctgacacacgtcagtgtcgaactctcgtatgacacttgtatgacatgtgtcggacaactaagacaagtgtccc |
11063734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 195
Target Start/End: Original strand, 11063784 - 11063816
Alignment:
| Q |
163 |
acacacgtgtcggacaactaaaacgagtgtccc |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
11063784 |
acacacgtgtcggacaactaagacgagtgtccc |
11063816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University