View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12525_high_11 (Length: 230)
Name: NF12525_high_11
Description: NF12525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12525_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 27 - 212
Target Start/End: Complemental strand, 5116672 - 5116487
Alignment:
| Q |
27 |
ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgcttatctc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5116672 |
ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgtttatctc |
5116573 |
T |
 |
| Q |
127 |
aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgcattttctcttgtttcaaacgttctgattaaact |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
5116572 |
aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgccttttctcttgtttcaaacgttctaattaaact |
5116487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University