View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12525_high_4 (Length: 375)
Name: NF12525_high_4
Description: NF12525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12525_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 267
Target Start/End: Complemental strand, 49910661 - 49910394
Alignment:
| Q |
7 |
agaacctgtggtaaatgaagactactcatagtcaaagatatacaactgtgaatgagaaccggtagtaaacagggaaatatgcatagttgaggaagacaag |
106 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910661 |
agaaccggtagtaaatgaagactactcatagtcaaagatatacaactgtgaatgagaaccggtagtaaacagggaaatatgcatagttgaggaagacaag |
49910562 |
T |
|
| Q |
107 |
acccatct-------gtgaacacgagataaaaatataatcaatttcatcttgaaccaattgctctgaaatcaattctacgcattactaggaatccgggca |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910561 |
acccatctcccatctgtgaacacgagataaaaatataatcaatttcatcttgaaccaattgctctgaaatcaattctacgcattactaggaatccgggca |
49910462 |
T |
|
| Q |
200 |
aagaggagaatcatttacgagtaaaacctagtattgatttctcttaaacaagaaccattataaagagg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49910461 |
aagaggagaatcatttacgagtaaaacctagtatcgatttctcttaaacaagaaccattataaagagg |
49910394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 297 - 375
Target Start/End: Complemental strand, 49910364 - 49910286
Alignment:
| Q |
297 |
tgcattgtattagatggagagacacaatggttgcaaatgcgagacgactagagaggaagagcaacgcaagacaaataag |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910364 |
tgcattgtattagatggagagacacaatggttgcaaacgcgagacgactagagaggaagagcaacgcaagacaaataag |
49910286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University