View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12525_high_8 (Length: 251)
Name: NF12525_high_8
Description: NF12525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12525_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 52699544 - 52699304
Alignment:
| Q |
1 |
ttcttcgacttgtgtcactgtgcatacactccatctgttactaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaattaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52699544 |
ttcttcgacttgtgtcactgtgcatacactccatctgttgctaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaattaattt |
52699445 |
T |
 |
| Q |
101 |
gctccaatcttatagacccaaataaaactaagactaaattacacttctggttatattaaggtttgacttcgttccctagatactgttttattcaatttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52699444 |
gctccaatcttatagacccaaataaaactaagactaaattacacttctggttatattaaggtttgacttcgttccctagatactgttttattcaatttta |
52699345 |
T |
 |
| Q |
201 |
gttccttactctacaaacctttgtaactttgaccttctctg |
241 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52699344 |
gttccttactctacaaaactttgtaactttgaccttctctg |
52699304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 52722840 - 52722728
Alignment:
| Q |
1 |
ttcttcgacttgtgtcactgtgcatacactccatctgttactaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaattaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722840 |
ttcttcgacttgtgtcactgtgcatacactccatctgttgctaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaattaattt |
52722741 |
T |
 |
| Q |
101 |
gctccaatcttat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52722740 |
gctccaatcttat |
52722728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 52713817 - 52713706
Alignment:
| Q |
2 |
tcttcgacttgtgtcactgtgcatacactccatctgttactaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaattaatttg |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| || | |||||| |||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52713817 |
tcttccacttgtgtcactgtgcatacactccatctgttgctgagtgtgtccttttctgtaataactgctgctttgtcaaaaaatctgcaaaattaatttg |
52713718 |
T |
 |
| Q |
102 |
ctccaatcttat |
113 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
52713717 |
ctccgatcttat |
52713706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University