View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12525_low_7 (Length: 272)
Name: NF12525_low_7
Description: NF12525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12525_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 469501 - 469264
Alignment:
| Q |
19 |
ttaatatgtattagtatcagacagataacgtgtctagacacgcatgagtggaactgagagttagaagcgattgaatgtaattatatatgtcggtagtaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
469501 |
ttaatatgtattagtatcagacagataacgtgtttagacacgcatgagtggaactgagagttagaagcgattgaatgtaattatatatgtccgtagtaat |
469402 |
T |
 |
| Q |
119 |
ttgagaaaatggaagttataattagaaacgactgagtgtaatcatatgcgtcacatatcatatggcatgtatgagacatgtcttcaatatgaagtctcaa |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
469401 |
ttgagaaaatggaagttatagttagaaacgattgagtgtaatcatatgtgtcacatatcatatggcatgtatgagacatgtcttcaatatgaagtctcaa |
469302 |
T |
 |
| Q |
219 |
tactacataccatatgaccattctttgtttttattttg |
256 |
Q |
| |
|
||||||||| ||||||| |||| |||| |||||||||| |
|
|
| T |
469301 |
tactacatatcatatgaacattttttgattttattttg |
469264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University