View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12526_low_2 (Length: 429)
Name: NF12526_low_2
Description: NF12526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12526_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 7 - 414
Target Start/End: Complemental strand, 41418604 - 41418189
Alignment:
| Q |
7 |
ggacgtaggagctggatagaaaaattttcatttttcaacatatcgagatgggggctcacgaagaaaccttggtggaagcagcgctccgagttttgaacac |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418604 |
ggacgtaggagctggatagagaaattttcatttttcaacatatcgagatgggggctcacgaagaaaccttggtggaagcagcgctccgagttttgaacac |
41418505 |
T |
|
| Q |
107 |
cgccgacccattcgagaaggcgcgactcggcgactcagtagcttcacggtggctcgatggcaccatcgccgaaccctacaacccttccctcacccttccc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418504 |
cgccgacccattcgagaaggcgcgactcggcgactcagtagcttcacggtggctcgatggcaccatcgccgaaccctacaacccttccctcacccttccc |
41418405 |
T |
|
| Q |
207 |
atccctgatcgccccgcaaggctctccagtgtctctgcactttctttccaataatccttttactgtgttcgacgaaattcctcactgacataaatggctt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418404 |
atccctgatcgccccgcaaggctctccagtgtctctgcactttctttccaataatccttttactgtgttcgacgaaattcctcactgacataaatggctt |
41418305 |
T |
|
| Q |
307 |
at--------tttgcaggtgaagttggtggctccgagtctcatgccgaagttgggtaaagcaggaagcttgcaaagcagggtgaacattgtgcatagtct |
398 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418304 |
attttgttgttttgcaggtgaagttggtggctccgagtctcatgccgaagttgggtaaagcaggaagcttgcaaagcagggtgaacattgtgcatagtct |
41418205 |
T |
|
| Q |
399 |
tgctcatattgagagt |
414 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41418204 |
tgctcatattgagagt |
41418189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University