View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12527_high_15 (Length: 236)
Name: NF12527_high_15
Description: NF12527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12527_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 13896950 - 13896729
Alignment:
| Q |
1 |
cttcaattaaggtcacaatgttttggtagtattcaagtttcatccct--gattgnnnnnnnntgttttatcataagattgaaacaattttt-gtcatgtt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| || ||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13896950 |
cttcaattaaggtcacaatgttttggtagtattcaagtttaatctctctgattgaaaaaaaatgttttatcataagattgaaacaattttttgtcatgtt |
13896851 |
T |
|
| Q |
98 |
ttcatctcaaaattagtccggacactttttctagaaatcttagggttaagacttaaacatattcatgttaatcataatttcatttgataaagtgaaactt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13896850 |
ttcatctcaaaattagtccggacactttttctagaaatcttaaggttaagacttaaacatattcatcttaatcataatttcatttgataaagtgaaactt |
13896751 |
T |
|
| Q |
198 |
aagctttagataagcatgcttc |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13896750 |
aagctttagataagcatgcttc |
13896729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University