View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12527_high_8 (Length: 312)
Name: NF12527_high_8
Description: NF12527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12527_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 16 - 307
Target Start/End: Original strand, 35212751 - 35213042
Alignment:
| Q |
16 |
cagatactgcacgattgatatcttcttgatcaccttcagcaacatgagcaatcacttccccagttcttgggtcataagcaggaaaagtttttcctattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212751 |
cagatactgcacgattgatatcttcttgatcaccttcagcaacatgagcaatcacttccccagttcttgggtcataagcaggaaaagtttttcctattca |
35212850 |
T |
 |
| Q |
116 |
ccaataataaattgtcacaactacactccactatgtataacattagaggtattagtatactattaaatcacatgaacctgatgcagcatccacaaatttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35212851 |
ccaataataaattgtcacaactacactccactatgcataacattagaggtattagtatactattaaatcacatgaacctgatgcagcatccataaatttc |
35212950 |
T |
 |
| Q |
216 |
ccattaatgagattctttgtgtatcttatttccacagatggtgtgattaattcatcaacttcagcagcagtgctcaacttgcctatgcttct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
35212951 |
ccattaatgagattctttgtgtatcttatttccacagatggtgtgattaattcatcaacttcagcagcagtgctcaacttgcttatgtttct |
35213042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 39294064 - 39294009
Alignment:
| Q |
21 |
actgcacgattgatatcttcttgatcaccttcagcaacatgagcaatcacttcccc |
76 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
39294064 |
actgcacggttaatatcttcagcatcaccttcagcaacgtgagcaatcacttcccc |
39294009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 44000217 - 44000272
Alignment:
| Q |
21 |
actgcacgattgatatcttcttgatcaccttcagcaacatgagcaatcacttcccc |
76 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44000217 |
actgcacggttaatatcttcagcatcaccttcagcaacatgagcaatcacttcccc |
44000272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 8357662 - 8357717
Alignment:
| Q |
21 |
actgcacgattgatatcttcttgatcaccttcagcaacatgagcaatcacttcccc |
76 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
8357662 |
actgcacggttaatatcttcagcatcaccttcagcaacgtgagcaatcacttcccc |
8357717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University