View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12527_low_20 (Length: 204)
Name: NF12527_low_20
Description: NF12527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12527_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 5035803 - 5035640
Alignment:
| Q |
18 |
aacaacaccttcaaccttcctcgtcctgatgggaatctaggtttcaccgataacccccgcagaataaggtctctctaccacgtctcaaaacaagatctgt |
117 |
Q |
| |
|
|||||||| ||||| |||| ||||||| |||||||||||||||| ||||| ||||||||||||||| ||||||||| ||||||||| |||||||| || |
|
|
| T |
5035803 |
aacaacacattcaaacttcttcgtcctaatgggaatctaggttttgccgatcacccccgcagaataaagtctctctatcacgtctcagaacaagatatgc |
5035704 |
T |
 |
| Q |
118 |
ccatcaccaacagtagtttcaggtctctctccctcgtttcaaaacagtttctgtccatcaccaa |
181 |
Q |
| |
|
| ||||| |||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5035703 |
caatcacaaacagtagtttcaggtctctttccttcgtttcaaaacagtttctctccatcaccaa |
5035640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 2525938 - 2525775
Alignment:
| Q |
18 |
aacaacaccttcaaccttcctcgtcctgatgggaatctaggttt-caccgataacccccgcagaataaggtctctctaccacgtctcaaaacaagatctg |
116 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||| ||||||| || | ||| || ||||||||| | ||||||||||||||||||||||| ||| |
|
|
| T |
2525938 |
aacaacaccttcaaccttcttcgtcttgatgggaatataggttttcaac-atatccagcgcagaataggaactctctaccacgtctcaaaacaatctcta |
2525840 |
T |
 |
| Q |
117 |
tccatcaccaacagtagtttcaggtctctctccctcgtttcaaaacagtttctgtccatcaccaa |
181 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2525839 |
cccatcaccaacggtagtttcagatctctctccctcgtctcaaaacagtttctgtccatcaccaa |
2525775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 181
Target Start/End: Complemental strand, 2486373 - 2486325
Alignment:
| Q |
133 |
gtttcaggtctctctccctcgtttcaaaacagtttctgtccatcaccaa |
181 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2486373 |
gttttaggtctctctccctcgtctcaaaacagtttctgtccatcaccaa |
2486325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 137 - 181
Target Start/End: Complemental strand, 2536647 - 2536603
Alignment:
| Q |
137 |
caggtctctctccctcgtttcaaaacagtttctgtccatcaccaa |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2536647 |
caggtctctctccctcatttcaaaacagtttctgtccatcaccaa |
2536603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 132 - 178
Target Start/End: Complemental strand, 2491195 - 2491149
Alignment:
| Q |
132 |
agtttcaggtctctctccctcgtttcaaaacagtttctgtccatcac |
178 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2491195 |
agtttcaggtctctctcactcgtctcaaaacagtttctgtccatcac |
2491149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 132 - 181
Target Start/End: Complemental strand, 2467597 - 2467548
Alignment:
| Q |
132 |
agtttcaggtctctctccctcgtttcaaaacagtttctgtccatcaccaa |
181 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| ||||||| ||||| |
|
|
| T |
2467597 |
agtttcaagtctctctccgtcgtctcaaaacagtttttgtccattaccaa |
2467548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 181
Target Start/End: Complemental strand, 2519279 - 2519251
Alignment:
| Q |
153 |
gtttcaaaacagtttctgtccatcaccaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2519279 |
gtttcaaaacagtttctgtccatcaccaa |
2519251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 184
Target Start/End: Original strand, 44575183 - 44575227
Alignment:
| Q |
140 |
gtctctctccctcgtttcaaaacagtttctgtccatcaccaatcg |
184 |
Q |
| |
|
|||||||||| |||| |||||||||||||| || ||||||||||| |
|
|
| T |
44575183 |
gtctctctccatcgtctcaaaacagtttctctcaatcaccaatcg |
44575227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University