View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12528_high_29 (Length: 215)

Name: NF12528_high_29
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12528_high_29
NF12528_high_29
[»] chr1 (1 HSPs)
chr1 (1-199)||(38304692-38304890)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 38304692 - 38304890
Alignment:
1 gattgatatgtttgtaaaatgtgaaagtttggaagatgcgcgtaaggtgtttgatgaaatgaatgttagagatttggcgacttggactgcgttgatttgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
38304692 gattgatatgtttgtaaaatgtgaaagtttggaagatgcgcgtaaggtgtttgatgaaatgaatgtgagagatttggcgacttggactgcgttgatttgt 38304791  T
101 gggaatgtgtggaatggtgaatgggatgaagcggttttgttgtttaggaagatgagattggaaggtttgaaggctgattcggttattgtggcgtctgtg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38304792 gggaatgtgtggaatggtgaatgggatgaagcggttttgttgtttaggaagatgagattggaaggtttgaaggctgattcggttattgtggcgtctgtg 38304890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University