View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_high_30 (Length: 213)
Name: NF12528_high_30
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 1828832 - 1828652
Alignment:
| Q |
15 |
gagaagaaagtgaatgagtggtagcattgaataaatttgaaagatcatgcaagatgaaaaatcactgaagataataaaagggatggaacaagagaaaatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1828832 |
gagaagaaagtgaatgagtggtagcattgaataaatttgaaagatcatgcaagatgaaaaatcactgaagataataaaagggatggaacaagagaaaatg |
1828733 |
T |
 |
| Q |
115 |
ccgcgggatgcacaatttgaactcatttcactatccattttcggtgttcaannnnnnncctgagaatttgatgcgttttat |
195 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
1828732 |
ctgcgggatgcacaatttgaactcatttcactgtccattttcggtgttcaatttttttcctgagaatttgatgctttttat |
1828652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University