View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_18 (Length: 301)
Name: NF12528_low_18
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 14 - 282
Target Start/End: Complemental strand, 3448904 - 3448636
Alignment:
| Q |
14 |
cagagaaggtgcagcgatgataaggattcaaggagaggtgaaaaattcaggtaacattgcgaaaactgtaatgcacgtaaggtgtttgatgaaagaatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3448904 |
cagagaaggtgcagcgatgataaggattcaaggagaggtgaaaaattcaggtaacattgcgaaaactgtaatgcatgtaaggtgtttgatgaaagaattg |
3448805 |
T |
 |
| Q |
114 |
agagtgcttagtaatatggatgacgatgaagttttcacgttttcgaagagaattcaagcgccttatgatattgttgcgcagacgaaacagatgggtagat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448804 |
agagtgcttagtaatatggatgacgatgaagttttcacgttttcgaagagaattcaagcgccttatgatattgttgcgcagacgaaacagatgggtagat |
3448705 |
T |
 |
| Q |
214 |
tacctgttgtgcattttgctgccagtgggattgtgactccggcggacgcagcgttgatgatgcagttgg |
282 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3448704 |
tacctgttgtgcattttgctgccggtgggattgtgactcccgcggacgcggcgttgatgatgcagttgg |
3448636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University