View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_21 (Length: 267)
Name: NF12528_low_21
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 252
Target Start/End: Complemental strand, 50966096 - 50965859
Alignment:
| Q |
15 |
gtttgtttgttgagtaatttaagctaatgtccttgaacgaaatatttctcattttggttaattttctctaatttgatcttccaacagtttatacnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50966096 |
gtttgtttgttgagtaatttaagctaatgtccttgaacgaaatatttctcattttggttaattttctctaatttgatcttccaacagtttatactttttt |
50965997 |
T |
|
| Q |
115 |
nnagactaggaactaggaatagctattaaagtaagtatagatacatgtcagttgctgctgcattgcgagaagcagggccggccctgtggctgtgcaacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965996 |
ttagactaggaactaggaatagctattaaagtaagtatagatacgtgtcagttgctgctgcattgcgagaagcagggccggccctgtggctgtgcaacaa |
50965897 |
T |
|
| Q |
215 |
ggccctttgcacagggaataaaaattaaatgggatcag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965896 |
ggccctttgcacagggaataaaaattaaatgggatcag |
50965859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University