View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_23 (Length: 262)
Name: NF12528_low_23
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 50965621 - 50965882
Alignment:
| Q |
1 |
atttgcaatgtatgcataatacataccggataccttaagccccacatcagaagtgttgagtaaataannnnnnnaaattggatataaatatgaactagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50965621 |
atttgcaatgtatgcataatacataccggataccttaagccccacatcggaggtgttgagtaaataagggggggaaattggatataaatatgaactagtg |
50965720 |
T |
 |
| Q |
101 |
aataactttgtaacgtgcagtgaagaacgatgcactagtggtgtgttggtcttacgcacattaaagaagcgctgaccatcttccacaaccaaatgcagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965721 |
aataactttgtaacgtgcagtgaagaacgatgcactagtggtgtgttggtcttacgcacattaaagaagcgctgaccatcttccacaaccaaatgcagta |
50965820 |
T |
 |
| Q |
201 |
ataaaattatagtaattaatctgagagaaatttaggccctgatcccatttaatttttattcc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965821 |
ataaaattatagtaattaatctgagagaaatttaggccctgatcccatttaatttttattcc |
50965882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University