View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_24 (Length: 242)
Name: NF12528_low_24
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 82 - 224
Target Start/End: Complemental strand, 30266596 - 30266458
Alignment:
| Q |
82 |
tgtattattaatacaaaaaagaggtaactgttttgagagaaaaggtatagaaactgtgtgcatgtgaaggtggatgaacgtgaacgtggttactcactca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30266596 |
tgtattattaatacaaaaaagaggtaactgttttgagagaaaaggtatagaaactgtgtgcatgtgaaggtggatgaacgtgaacgtgg----tcactca |
30266501 |
T |
 |
| Q |
182 |
ctcactatgcaactttttcacgcggtttagtaaaatttgaaca |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30266500 |
ctcaccatgcaactttttcacgcggtttagtaaaatttgaaca |
30266458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University