View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_26 (Length: 238)
Name: NF12528_low_26
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 44374974 - 44375204
Alignment:
| Q |
7 |
gagaagcaaaggactgcagattttgtccattggatgccatagcatctgcagctgcattgccatctaaaatcaatatgttgagtaaagtgcttgtagttca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44374974 |
gagaagcaaaggactgcagattttgtccattggatgccatagcatctgcagctgcattgccatctaaaatcaatatgttgagtaaagtgcttgtagttca |
44375073 |
T |
 |
| Q |
107 |
accatctattccttccttagacactacactctctaaacatgtgggagcatctaaaatcaatatgtttagagaaaataaatatgtaacttttataaacaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44375074 |
accatctattccttccttagacactacactctcaaaacatgtgggagcatctaaaatcaatatgtttagaggaaataaatatgtaacttttataaacaaa |
44375173 |
T |
 |
| Q |
207 |
agcatttgaagcataggcatagatggtagtg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44375174 |
agcatttgaagcataggcatagatggtagtg |
44375204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University