View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_30 (Length: 216)
Name: NF12528_low_30
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 49431361 - 49431549
Alignment:
| Q |
9 |
gagagagaagaatgaccaatggaatgagggatctgtgaannnnnnnggtgctactattgcatgtatgaagaattaggggttggtttatacgagggccttt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49431361 |
gagagacaagaatgaccaatggaatgagggatctgttaatttttttggtgctaccattgcatgtatgaagaattaggggttggtttatacgagggccttt |
49431460 |
T |
|
| Q |
109 |
gcatagctagaaggcagagaatattaagaattgaagttcaaatggattcattgggagtgattcgatcactgtgattcagaatttacaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49431461 |
gcatagctagaaggcagagaatattaagaattgaagttcaaatggattcattgggagtgattcgatcactgtgattcagaatttacaac |
49431549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University