View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_31 (Length: 215)
Name: NF12528_low_31
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 38304692 - 38304890
Alignment:
| Q |
1 |
gattgatatgtttgtaaaatgtgaaagtttggaagatgcgcgtaaggtgtttgatgaaatgaatgttagagatttggcgacttggactgcgttgatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38304692 |
gattgatatgtttgtaaaatgtgaaagtttggaagatgcgcgtaaggtgtttgatgaaatgaatgtgagagatttggcgacttggactgcgttgatttgt |
38304791 |
T |
 |
| Q |
101 |
gggaatgtgtggaatggtgaatgggatgaagcggttttgttgtttaggaagatgagattggaaggtttgaaggctgattcggttattgtggcgtctgtg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38304792 |
gggaatgtgtggaatggtgaatgggatgaagcggttttgttgtttaggaagatgagattggaaggtttgaaggctgattcggttattgtggcgtctgtg |
38304890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University