View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12528_low_6 (Length: 473)
Name: NF12528_low_6
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12528_low_6 |
 |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0060 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 80 - 459
Target Start/End: Complemental strand, 39441 - 39061
Alignment:
| Q |
80 |
cctagtgtttattccttcatgggtatctccaaaaacaagcttacaagtaaattcccatgaattggagtgaaaatggaagttttgaaaaatgaagggagag |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
39441 |
cctagtgtttattccttcatcggtatctccaaaaacaagcttacaagtaaattcccatgaattggagtgataatggaagttttggaaaatgaagggagag |
39342 |
T |
 |
| Q |
180 |
gggcggatcaccaagaatggagggaaaagtggttttgaagcttggctcttgcttaaaactctacatggaactcctttgtagcatgatttgatgattccat |
279 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39341 |
gggcagttcaccaagaatggagggaaaagtggttttgaaggttggctcttgcttaaaactttacatggaactcctttgtagcatgatttgatgattccat |
39242 |
T |
 |
| Q |
280 |
ggaaaaatttgatgaattttgatggattggggtgaagtagagagggaggacgtgtgctagagagggggaggaaggaaaaatccaga--ttttttccaatg |
377 |
Q |
| |
|
| ||| ||||||||||||||||||||| | ||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |||||| ||||| |
|
|
| T |
39241 |
gaaaatttttgatgaattttgatggattagagtgaagtagagagagaggacgtgtgctagaga--gggaggaaggaaaaattcagatttttttttcaatg |
39144 |
T |
 |
| Q |
378 |
agagaatagtgtagaaacttgtagaaaatttatat-aatttgtcttatatacaccctttgtcggaaaacaccattttaccctc |
459 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||| | ||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
39143 |
agagaatagtgtaggaacttgtagaaaatctatatgattttgtcttatatacaccctttgtgggaaaagaccattttaccctc |
39061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 39610 - 39545
Alignment:
| Q |
18 |
catagctccttatgcatccaaaaacaggtcactaacatcattatccacaacatagttgcattcctag |
84 |
Q |
| |
|
||||||||||||| ||||||||| || ||||| ||||||||| ||||||||||| || ||||||||| |
|
|
| T |
39610 |
catagctccttatacatccaaaa-catgtcaccaacatcattgtccacaacataatttcattcctag |
39545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 431
Target Start/End: Original strand, 15089626 - 15089669
Alignment:
| Q |
388 |
gtagaaacttgtagaaaatttatataatttgtcttatatacacc |
431 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
15089626 |
gtagaaacttgtagaaaaatcatacaatttgtcttatatacacc |
15089669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 431
Target Start/End: Original strand, 22212236 - 22212279
Alignment:
| Q |
388 |
gtagaaacttgtagaaaatttatataatttgtcttatatacacc |
431 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
22212236 |
gtagaaacttgtagaaaaatcatacaatttgtcttatatacacc |
22212279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University