View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_high_15 (Length: 292)
Name: NF1252_high_15
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 71 - 246
Target Start/End: Original strand, 22192235 - 22192412
Alignment:
| Q |
71 |
gagaaatcggctttagtgtaaa-aattgttttgtatatagttttgacgcatcattaccatcttcaacaatgtcacgggattccattttttgttagtaagt |
169 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22192235 |
gagaaatcggctttagtgtaaacaattgttttgtatatagttttgacgcatcattaccatcttcaacaatgtcacgggattccattttttgttagtaagt |
22192334 |
T |
|
| Q |
170 |
gcagatatcttctac-tttttctattgcttttctcaccctcctttcttcagaaactgatggtatttccctttgcttct |
246 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
22192335 |
gaagatatcttctacttttttctattgcttttctcaccctcctttcttcagaaactgatggtatttccttttgtttct |
22192412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 150
Target Start/End: Complemental strand, 13684084 - 13684005
Alignment:
| Q |
72 |
agaaatcggctttagtgtaaa-aattgttttgtatatagttttgacgcatcattaccatcttcaacaatgtcacgggatt |
150 |
Q |
| |
|
|||||||||||||||||| || || | ||| ||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
13684084 |
agaaatcggctttagtgtcaacaactctttaatatatagttttgacgcatcattataatcttcaacaatgtcatgggatt |
13684005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 153
Target Start/End: Original strand, 36996129 - 36996211
Alignment:
| Q |
72 |
agaaatcggctttagtgtaaaaattgtttt-gtatatagttttgacgcatcattaccatcttcaacaatgtcacgggattcca |
153 |
Q |
| |
|
|||||||||||||||||| || | |||||| ||||||||||||||| ||| ||| |||||||||||||||| | ||||||||| |
|
|
| T |
36996129 |
agaaatcggctttagtgtcaacaatgttttcgtatatagttttgacacattatttccatcttcaacaatgttatgggattcca |
36996211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 8598783 - 8598850
Alignment:
| Q |
72 |
agaaatcggctttagtgtaaaa-attgttttgtatatagttttgacgcatcattaccatcttcaacaa |
138 |
Q |
| |
|
|||||||||||||| ||| || ||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8598783 |
agaaatcggctttactgtgaacgatttttttggatatagttttgacgcatcattaccatcttcaacaa |
8598850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University