View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1252_high_21 (Length: 228)

Name: NF1252_high_21
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1252_high_21
NF1252_high_21
[»] chr2 (2 HSPs)
chr2 (7-92)||(13542290-13542375)
chr2 (118-184)||(13542366-13542433)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 13542290 - 13542375
Alignment:
7 gttttgaaagtctcatcatcatgtccaatatgatttttaaaacaaaacctactggtttgctaaaccgttaaaaagaaattagaata 92  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||    
13542290 gttttgaaagtctcatcatcttgtccaatatgatttttaaaacaaaacctactggtttgataaaccgttaaaagggaattagaata 13542375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 118 - 184
Target Start/End: Original strand, 13542366 - 13542433
Alignment:
118 aattagaatatatcgaaacaacacaaatttt-acgatactaaaattaaagaagataaaattgtgaata 184  Q
    |||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
13542366 aattagaatacatcgaaacaacacaaatttttatgatactaaaattaaagaagataaaattgtgaata 13542433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University