View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_18 (Length: 329)
Name: NF1252_low_18
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 99 - 307
Target Start/End: Original strand, 9058377 - 9058585
Alignment:
| Q |
99 |
gtttaaaaggtttaaatccaattccactcggaccaaatataatgttgatagcggcacnnnnnnnnnaactctttgtacaatcatattgagctgcattatt |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9058377 |
gtttaaaaggttcaaatccaattccactcggaccaaatataatgttgatagcggcactttttttt-aactctttgtacaatcatattgagctgcattatt |
9058475 |
T |
|
| Q |
199 |
ttgcaagctctaatatatggtaaggtatgttacaagtatattattcctt-nnnnnnnnnntattacaagtatattatatatagtataagtgcacttatga |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9058476 |
ttgcaagctctaatatatggtaaggtatgttacaagtatattattccttcaaaaaaaaaatattacaagtatattatatatagtataagtgcacttatga |
9058575 |
T |
|
| Q |
298 |
atttcttcac |
307 |
Q |
| |
|
|||||||||| |
|
|
| T |
9058576 |
atttcttcac |
9058585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University