View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_19 (Length: 329)
Name: NF1252_low_19
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 99 - 321
Target Start/End: Complemental strand, 36653699 - 36653478
Alignment:
| Q |
99 |
atacttctacgaaaaacttgattaggataaatgttgaaattgnnnnnnnnnnnnnatgacagaacaacttgaaataagccaagggaaagaggaaggggag |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36653699 |
atacttttacgaaaaacttgattaggataaatgttgaaattgttttttctttttt-tgacagaacaacttgaaataagccaagggaaagaggcaggggag |
36653601 |
T |
|
| Q |
199 |
ttattgcaatgggaggatattcagaaaatgaaatattcttggaatgttgcttctgaagttctgaggctgtcgccacctgtcggtggcgcattcagagatg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36653600 |
ttattgcaatgggaggatattcagaaaatgaaatattcttggaatgttgcttctgaagttctgaggctgtcgccacctgtcggtggcgctttcagagatg |
36653501 |
T |
|
| Q |
299 |
ctataaaggattttacctatgct |
321 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36653500 |
ctataaaggattttacctatgct |
36653478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University