View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_22 (Length: 310)
Name: NF1252_low_22
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_22 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 105 - 310
Target Start/End: Complemental strand, 8155944 - 8155730
Alignment:
| Q |
105 |
tcttttatacccttgtttattttaaaaacaacttaatattaatttctttttgagcactcttcattagtc-ttgatgattcggtcatttctttcatttaca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
8155944 |
tcttttatacccttgtttattttaaaaacaacttaatattaatttctttttgagcactcttcattagtctttgatgattcggtcatttctttgatttaca |
8155845 |
T |
|
| Q |
204 |
a---------aacgaataattatttatatcatcatcgcgattcataagtctgagtataattttctacaaaattcgacacatttgaatcacttgatgatta |
294 |
Q |
| |
|
| ||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8155844 |
aaacgagtagaacgagtaattatttataccatcatcgcgattcataagtc-gagtataattttctacaaaattcgacacatttgaatcacttgatgatta |
8155746 |
T |
|
| Q |
295 |
tagtttcaaattagcc |
310 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8155745 |
tagtttcaaattagcc |
8155730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 84 - 117
Target Start/End: Complemental strand, 8156006 - 8155973
Alignment:
| Q |
84 |
ataactatgcacttgccaaactcttttataccct |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
8156006 |
ataactatgtacttgccaaactcttttataccct |
8155973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University