View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1252_low_25 (Length: 266)

Name: NF1252_low_25
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1252_low_25
NF1252_low_25
[»] chr8 (1 HSPs)
chr8 (22-223)||(42003149-42003350)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 42003350 - 42003149
Alignment:
22 gtagcatagggaggatcagacatcatagccacaatcgaataattcatgttcttatcgttgttgatactactaatagagcttaaattcaaacaacttatag 121  Q
    |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42003350 gtagcaaaaggaggatcagacatcatagccacaatcgaataattcatgttcttatcgttgttgatactactaatagagcttaaattcaaacaacttatag 42003251  T
122 gtggtactaaatttattacggttgaattggaaggacaatttaggaatgaaaaattaacaaaagtgtaataatcacttaaccgaaacggtgaatctttaag 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42003250 gtggtactaaatttattacggttgaattggaaggacaatttaggaatgaaaaattaacaaaagtgtaataatcacttaaccgaaacggtgaatctttaag 42003151  T
222 gt 223  Q
    ||    
42003150 gt 42003149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University