View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_29 (Length: 256)
Name: NF1252_low_29
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 30 - 103
Target Start/End: Original strand, 46565285 - 46565358
Alignment:
| Q |
30 |
cgcatggtagcatctttgagtggcttatatgacaaagagtgcatgttgtgcagcttcaagactttcgttcttca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46565285 |
cgcatggtagcatctttgagtggcttatatgacaaagagtgcatgttgtgcagcttcaagactttcgttcttca |
46565358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University