View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_30 (Length: 251)
Name: NF1252_low_30
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 5 - 251
Target Start/End: Complemental strand, 42751975 - 42751728
Alignment:
| Q |
5 |
tctccaagaatatagtttggacttcctagctatgtttggagcttctcccagtatagacctcttaattcatctcttatgattggcctcttggacctactct |
104 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42751975 |
tctcaaagaaaatagtttggacttcctagctatgtttggagcttctcccagcatagatctcttagttcatctcttatgattggcctcttggacctactct |
42751876 |
T |
|
| Q |
105 |
ctccatactctatgagaacttggttatgtagagcttaatttgc-nnnnnnnnncctctccttttctggctttgtaattttagtcttttaaccnnnnnnnt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42751875 |
ctccatactctatgagaacttggttatgtagagcttaatttgcttttttttttcctctccttttctggctttgtaattttagtcttttaaccaaaaaaat |
42751776 |
T |
|
| Q |
204 |
caataaattgtaaagctacatctatataatttctaatcaaaaattgca |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42751775 |
caataaattgtaaagctagatctatataatttctaatcaaaaattgca |
42751728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University