View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_32 (Length: 228)
Name: NF1252_low_32
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 13542290 - 13542375
Alignment:
| Q |
7 |
gttttgaaagtctcatcatcatgtccaatatgatttttaaaacaaaacctactggtttgctaaaccgttaaaaagaaattagaata |
92 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||| |
|
|
| T |
13542290 |
gttttgaaagtctcatcatcttgtccaatatgatttttaaaacaaaacctactggtttgataaaccgttaaaagggaattagaata |
13542375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 118 - 184
Target Start/End: Original strand, 13542366 - 13542433
Alignment:
| Q |
118 |
aattagaatatatcgaaacaacacaaatttt-acgatactaaaattaaagaagataaaattgtgaata |
184 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
13542366 |
aattagaatacatcgaaacaacacaaatttttatgatactaaaattaaagaagataaaattgtgaata |
13542433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University