View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252_low_38 (Length: 201)
Name: NF1252_low_38
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 32319859 - 32319979
Alignment:
| Q |
1 |
cgccttttgaacatgaaaaatttgtcttgcaattaggtggtgggagacaacacaacacctcgactttgataccgatatttgtggacaaaaatgtggcttc |
100 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32319859 |
cgccttttgaacacgaaaaatgtgtcttgcaattaggtggtgggagacaacacaacacctcgactttgataccgatatttgtggacaaaaatgtggcttc |
32319958 |
T |
|
| Q |
101 |
gaattcaaaggatattgttgg |
121 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
32319959 |
gaattcaaaggatgttgttgg |
32319979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 2 - 126
Target Start/End: Original strand, 32366740 - 32366864
Alignment:
| Q |
2 |
gccttttgaacatgaaaaatttgtcttgcaattaggtggtgggagacaacacaacacctcgactttgataccgatatttgtggacaaaaatgtggcttcg |
101 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32366740 |
gccttttgaacctgaaaaatgtgtcttgcaattaggtggtaggagacaacacaacacctcggctttgataccgatatttgtggacaaaaatgtggcttca |
32366839 |
T |
|
| Q |
102 |
aattcaaaggatattgttggagatg |
126 |
Q |
| |
|
| |||||||||| | ||||| |||| |
|
|
| T |
32366840 |
agttcaaaggatgtagttggtgatg |
32366864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University