View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12530_low_5 (Length: 288)

Name: NF12530_low_5
Description: NF12530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12530_low_5
NF12530_low_5
[»] chr6 (2 HSPs)
chr6 (19-116)||(4326537-4326634)
chr6 (53-87)||(4330004-4330038)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 4326634 - 4326537
Alignment:
19 atatagaggagtggtattcgtatctcttgtatatttggatttggataacacttgttattagtttgttatatcataacttgtgacgcaagttttgcatg 116  Q
    |||||||||||||||||||||||||||||||   ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4326634 atatagaggagtggtattcgtatctcttgtagtattggaattggataacacttgttattagtttgttatatcataacttgtgacgcaagttttgcatg 4326537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 4330038 - 4330004
Alignment:
53 ttggatttggataacacttgttattagtttgttat 87  Q
    |||||||||||||||||||||||||||||||||||    
4330038 ttggatttggataacacttgttattagtttgttat 4330004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University