View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12530_low_5 (Length: 288)
Name: NF12530_low_5
Description: NF12530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12530_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 4326634 - 4326537
Alignment:
| Q |
19 |
atatagaggagtggtattcgtatctcttgtatatttggatttggataacacttgttattagtttgttatatcataacttgtgacgcaagttttgcatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4326634 |
atatagaggagtggtattcgtatctcttgtagtattggaattggataacacttgttattagtttgttatatcataacttgtgacgcaagttttgcatg |
4326537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 4330038 - 4330004
Alignment:
| Q |
53 |
ttggatttggataacacttgttattagtttgttat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4330038 |
ttggatttggataacacttgttattagtttgttat |
4330004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University