View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12530_low_7 (Length: 263)
Name: NF12530_low_7
Description: NF12530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12530_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 63 - 253
Target Start/End: Original strand, 963146 - 963335
Alignment:
| Q |
63 |
agtagtttcacagtttgatatatggactgatcaaggtaatatttgttccaaacaggttgcagaatatggagaagaaggagaagttgttggagtgataagg |
162 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
963146 |
agtagtttcacagtttgatat-tggactaatcaatgtaatatttgttccaaacaggttgcagaatatgaagaagaaggagaagttgctggagtgataagg |
963244 |
T |
 |
| Q |
163 |
ggttgtgtgaaaacagttacaagagggaattcagcttatgtaaaactagcttatgttttaggacttagagtctctcccaaacacaggttct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
963245 |
ggttgtgtgaaaacagttacaagagggaattcagcttatgtaaaactagcttatgttttaggacttagagtctctcccaaacacaggttct |
963335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 54
Target Start/End: Original strand, 963020 - 963056
Alignment:
| Q |
18 |
gtatacctaatgcgacattatgttttagtgctgaata |
54 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
963020 |
gtatatctaatgcgacattatgttttagtgttgaata |
963056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University