View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12531_low_10 (Length: 251)
Name: NF12531_low_10
Description: NF12531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12531_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 47291302 - 47291391
Alignment:
| Q |
1 |
cagctctagtgaacgagatatgttaccaaaggacctacaatcctaatccatttaagattgtaaggttctcggatgtactagatgcaccgt |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
47291302 |
cagctctagtgaacgagatatgttaccaaaggacctacaatcctaatcaatttaagattgtaagattctcggatgtaccagatgcaccgt |
47291391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 129 - 244
Target Start/End: Original strand, 47291395 - 47291511
Alignment:
| Q |
129 |
gatcatcagtgtcactgttaataatttttttgaaccttatgacat--ttaatatattgttcatgtattcattcnnnnnnnnnnnngtcaaatagtctaat |
226 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47291395 |
gatcatcagtgtcgttgttaataatttttttgaaccttatgacatatttaatatattgttcatgtattcattctttcttttttt-gtcaaatagtctaat |
47291493 |
T |
|
| Q |
227 |
agttaaatattcatctct |
244 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
47291494 |
agttagatattcatctct |
47291511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 244
Target Start/End: Complemental strand, 2042957 - 2042925
Alignment:
| Q |
212 |
gtcaaatagtctaatagttaaatattcatctct |
244 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
2042957 |
gtcaaatagtctaatagttaaaaattcatctct |
2042925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University