View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12532_low_13 (Length: 342)
Name: NF12532_low_13
Description: NF12532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12532_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 34317381 - 34317230
Alignment:
| Q |
18 |
aaacaaatatcagacgtaatactcataatataaactttcaactttagaaattgagatgttaacagcacaacaaaaatcaagtaatttttcaaactacatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34317381 |
aaacaaatatcagacgtaatactcataatataaactttcaactttagaaattgagatgttaacagcacaacaaaaatcaagtaatttttcaaactacatg |
34317282 |
T |
 |
| Q |
118 |
gctcggtcgaccccagaaagtgtattaaactcaaaaactaaacctttgcttt |
169 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34317281 |
gctcggtcgaccctagaaagtgtattaaactcaaaaactaaacctttgcttt |
34317230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 204 - 331
Target Start/End: Complemental strand, 34317228 - 34317101
Alignment:
| Q |
204 |
ggtctactctcaatactgatgattctgtcggtcttctccatctactctaggatgtagaaccccgattttccctctaatgattatatttctaatctaacat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34317228 |
ggtctactctcaatactgatgattctgtcggtcttctccatttactctaggatgtagaaccccgattttccctctaatgattatatttctaatctaacat |
34317129 |
T |
 |
| Q |
304 |
ttgtcttacataactactcatgtttcat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34317128 |
ttgtcttacataactactcatgtttcat |
34317101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University