View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12533_high_10 (Length: 215)
Name: NF12533_high_10
Description: NF12533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12533_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 47 - 199
Target Start/End: Original strand, 4159731 - 4159883
Alignment:
| Q |
47 |
attaattcctgcaacatatgaatcacacatataaatagtagtataaccaattaaactctcattcnnnnnnncttccatttccatagcacaaaaatgaaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4159731 |
attaattcctgcaacatatgaatcacacatataaatagtagtataaccaattaaactctcattctttttttcttccatttccatagcacaaaaatgaaaa |
4159830 |
T |
 |
| Q |
147 |
tgccttctcttttaggttctattcatccacgctcattcttcttttgtttcatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4159831 |
tgccttctcttttaggttctattcatccacgctcattcttcttttgtttcatc |
4159883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 196
Target Start/End: Original strand, 4152602 - 4152674
Alignment:
| Q |
124 |
tttccatagcacaaaaatgaaaatgccttctcttttaggttctattcatccacgctcattcttcttttgtttc |
196 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| || |||||||| | | |||||| |||||||||||||||||| |
|
|
| T |
4152602 |
tttctatatcacaaaaatgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttc |
4152674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University