View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12533_high_5 (Length: 334)
Name: NF12533_high_5
Description: NF12533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12533_high_5 |
 |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 32650829 - 32650608
Alignment:
| Q |
1 |
tctttcattcgttcatctctctccaccgctctcatctgcttcttcgatc----tcagcatctcaattcgtttactctttcctttcattaatttgcattat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
32650829 |
tctttcattcgttcatctctctccaccgctctcatctgcttcttcgatcgatctcagcatctcaattcgtttactctttcctttcatttattttcattat |
32650730 |
T |
 |
| Q |
97 |
cgccgtgataaatggatcagaattgttctgatatttacacaaatataaacaaacccctcatgaaatgatttcagttaatcattatgattgttcacgttct |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650729 |
ggccgtgatgaatggatcagaattgttctgatatttacacaaatataaacaaacccctcatgaaatgatttcagttaatcattatgattgttcacgttct |
32650630 |
T |
 |
| Q |
197 |
ggtactttttcctttggattcc |
218 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32650629 |
ggtactttttcctttggattcc |
32650608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 214 - 319
Target Start/End: Complemental strand, 12537407 - 12537299
Alignment:
| Q |
214 |
attcctaacgcccctgatgtt---tactttcttccaaggaagttttaccacacatttgagaagtccttgccaaaatctgatgtcaactcaggatttttgg |
310 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
12537407 |
attcctaacgcccctgatgttgtttactttcttccaaggaagttttaccacacatttgagaagtagttgccaaaatctgatgtcaactcaggttttttgg |
12537308 |
T |
 |
| Q |
311 |
tatgatgtc |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
12537307 |
tatgatgtc |
12537299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 214 - 319
Target Start/End: Original strand, 29175 - 29283
Alignment:
| Q |
214 |
attcctaacgcccctgatgtt---tactttcttccaaggaagttttaccacacatttgagaagtccttgccaaaatctgatgtcaactcaggatttttgg |
310 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
29175 |
attcctaacgcccttgatgttgtttactttcttccaaggaagttttaccactcatttgagaagtcgttgccaaaatctgatgtcaactcaggttttttgg |
29274 |
T |
 |
| Q |
311 |
tatgatgtc |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
29275 |
tatgatgtc |
29283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University