View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12533_low_11 (Length: 240)
Name: NF12533_low_11
Description: NF12533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12533_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 233
Target Start/End: Complemental strand, 13112859 - 13112629
Alignment:
| Q |
5 |
catcacttgtgtctctctctagtgcgacgtgtatgtctctatccnnnnnnnnnc-cttaatcttccatttcatcaagaaagaaccct-acttaatctggt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||| ||||||| |||| |
|
|
| T |
13112859 |
catcacttgtgtctctctctagtgcgacgtgtatgtctctatcctttttcttcttcttaatcttccagttcatcaagaaataaccctcacttaatttggt |
13112760 |
T |
|
| Q |
103 |
gttcgatcatgagctaaataaaatctggaaaaaacaaattgttctactcagagatcgaacttgagtatcgagtaccttacttgttaatttgtttgtatga |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| | |
|
|
| T |
13112759 |
gttcgatcctgagctaaataaaatctggaaaaaacaaattgttctactcagagatcgaacttgagtattgagtaccttacttgttaatttgtttatataa |
13112660 |
T |
|
| Q |
203 |
attaccatattatataggtgtctttcttctc |
233 |
Q |
| |
|
|||| ||||||||||||||| |||||||||| |
|
|
| T |
13112659 |
attatcatattatataggtgcctttcttctc |
13112629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University