View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12533_low_2 (Length: 567)
Name: NF12533_low_2
Description: NF12533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12533_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 1e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 251 - 319
Target Start/End: Original strand, 16374710 - 16374778
Alignment:
| Q |
251 |
gaatggaataaaatgcagtatctaatctaggtatcaataaattaagacatgtctgtctagcatattcta |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16374710 |
gaatggaataaaatgcagtatctaatctaggtatcaataaattaagacatgtctgtctagcatattcta |
16374778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 43 - 135
Target Start/End: Complemental strand, 16369105 - 16369013
Alignment:
| Q |
43 |
ttgatgaaacaaagactccagctttggtgaaatggactgaagcttttgctgctgatcctgctgtgaagggagttctaccagaaactgataaac |
135 |
Q |
| |
|
|||||||| | || ||||| ||||||| |||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16369105 |
ttgatgaagctaaaactccttctttggtaaaatgggctgaagcttttgctactgatcctgctgtgaagggaattctaccagaaactgataaac |
16369013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University