View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12533_low_7 (Length: 333)
Name: NF12533_low_7
Description: NF12533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12533_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 5229618 - 5229905
Alignment:
| Q |
1 |
atgttgttaatctttcaaagtcttatcttaattcttaaccagcaaagatgttaatttttcaagtcttgtcttaactcttaactaccatcattggcatagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5229618 |
atgttgttaatctttcaaagtcttatcttaattcttaaccacaaaagatgttaatctttcaagtcttgtcttaactcttaactaccatcattggcatagt |
5229717 |
T |
 |
| Q |
101 |
ttaatcacaactaatgaaccaaacatatatactatatatgctttaacttcactcctactcnnnnnnnnnnnnnnnnnnnntcattaaaccctctcaacaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5229718 |
ttaatcacaaccaatgaaccaaacatatatactatatatgctttaacttcactcctactc-aaaaaataaaaaaataaaatcattaaaccctctcaacaa |
5229816 |
T |
 |
| Q |
201 |
ttttatcatcattttgtttctcaatgcattaattcatactctttcttcacatctttaatcttcttccattcctcatgaacccttcagaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5229817 |
ttttatcatcattttgtttctcaatgcattaattcatactctttcttcacatctttaatcttcttccattcctcatgaacccttcagaa |
5229905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University