View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_high_18 (Length: 240)
Name: NF12535_high_18
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_high_18 |
 |  |
|
| [»] scaffold0634 (1 HSPs) |
 |  |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 36728597 - 36728376
Alignment:
| Q |
1 |
catgaagatatccgctccgtgtctgtggctgattttatccgcggatatccacggatgcaagnnnnnnngccatgcctatttaccatcttgtttatctnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||| | |
|
|
| T |
36728597 |
catgaagatatccgctccgtgtctgtggcggattttatccgcggatatccacggatgcgggtttttttgccatgcctgtttaccatcttgtttatgtaca |
36728498 |
T |
 |
| Q |
101 |
nnnnnnnnnnnngttaatctgcagtgtaatttagcctagttaaaataatcccggtaggtagttcgagtgcaaggaatgtggcagataacatgtttctatg |
200 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728497 |
aaaaaaaaa---gttaacctgcagtaaaatttagcctagttaaaattatcccggtaggtagttggagtgcaaggaatgtggcagataacatgtttctatg |
36728401 |
T |
 |
| Q |
201 |
gttaccaagaagg-cgtgattcttg |
224 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
36728400 |
gttaccaagaaggacgtgattcttg |
36728376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 25293775 - 25293726
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25293775 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatgc |
25293726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 54
Target Start/End: Complemental strand, 17562557 - 17562512
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
17562557 |
tatccgctccgtgtccatggcagattttatccgcggatatccacgg |
17562512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 42507343 - 42507299
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacg |
53 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
42507343 |
tatccgctccgtgtcagtggcagattttattcgcggatatccacg |
42507299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 46
Target Start/End: Original strand, 47141191 - 47141228
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggat |
46 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
47141191 |
tatccgctccgtgtccgtggcggattttatccgcggat |
47141228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 59
Target Start/End: Original strand, 36299203 - 36299257
Alignment:
| Q |
5 |
aagatatccgctccgtgtctgtggctgattttatccgcggatatccacggatgca |
59 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
36299203 |
aagatatccgctccgtgtccgtggcagattttatccgcgaatatccacggatgca |
36299257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 33189723 - 33189771
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
33189723 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatg |
33189771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 47925239 - 47925282
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccac |
52 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
47925239 |
tatccgttccgtgtccgtggcggattttatccgcggatatccac |
47925282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0634 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0634
Description:
Target: scaffold0634; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 8996 - 8947
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
8996 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatgc |
8947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0115 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 22379 - 22428
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
22379 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatgc |
22428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 39800170 - 39800121
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
39800170 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatgc |
39800121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 40057256 - 40057305
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
40057256 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatgc |
40057305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 54
Target Start/End: Original strand, 3926595 - 3926644
Alignment:
| Q |
5 |
aagatatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||| ||| |||||||||| |
|
|
| T |
3926595 |
aagatatccgctccgtgcctgtggcggattttatctgcgaatatccacgg |
3926644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 54
Target Start/End: Complemental strand, 35188349 - 35188304
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
35188349 |
tatccgctccgtgtccgtggcggattttatccgcggatatctacgg |
35188304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 42837909 - 42837953
Alignment:
| Q |
5 |
aagatatccgctccgtgtctgtggctgattttatccgcggatatc |
49 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
42837909 |
aagatatccgctctgtgtctgtggcgggttttatccgcggatatc |
42837953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 54
Target Start/End: Complemental strand, 39206858 - 39206813
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
||||||||| ||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
39206858 |
tatccgctctgtgcccgtggcggattttatccgcggatatccacgg |
39206813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 12149389 - 12149438
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
12149389 |
tatccgctccgtgtccgtggcggattttatccgcggatatccacggatgc |
12149438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 27926359 - 27926316
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccac |
52 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
27926359 |
tatccgctccgtgtccgtggcggattttatccgcggatatccac |
27926316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 50
Target Start/End: Complemental strand, 3778703 - 3778662
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatcc |
50 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
3778703 |
tatccgctccgtgcccgtggcggattttatccgcggatatcc |
3778662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 36582661 - 36582612
Alignment:
| Q |
5 |
aagatatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
36582661 |
aagatatccgctccgtgttcgtggcggattttatccgcggatatccacgg |
36582612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 8226966 - 8226916
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgca |
59 |
Q |
| |
|
||||| ||||||| | ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8226966 |
tatccactccgtgcccgtgacggattttatccgcggatatccacggatgca |
8226916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 54
Target Start/End: Complemental strand, 9762652 - 9762607
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||| ||||||||||| |
|
|
| T |
9762652 |
tatccgctccgtgcccgtggcggattttatccgcagatatccacgg |
9762607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 40568662 - 40568613
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
40568662 |
tatccgctccgtgtccgtggcgaattttatccgcggatatccacggatgc |
40568613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 54
Target Start/End: Original strand, 38952027 - 38952072
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
38952027 |
tatccgctccgtacctgtggcggattttatccgcggatatccacgg |
38952072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 8819016 - 8818972
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacg |
53 |
Q |
| |
|
|||||||| |||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
8819016 |
tatccgcttcgtgtccgtgacggattttatccgcggatatccacg |
8818972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 19842135 - 19842183
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatg |
57 |
Q |
| |
|
||||| ||||||||| ||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
19842135 |
tatccactccgtgtccgtggcggattttatccgtggatatccatggatg |
19842183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 43624741 - 43624781
Alignment:
| Q |
12 |
ccgctccgtgtctgtggctgattttatccgcggatatccac |
52 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
43624741 |
ccgctccgtgtccgtggcggattttatctgcggatatccac |
43624781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 5705002 - 5705051
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
|||||| |||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
5705002 |
tatccgttccgtgcccgtggcggattttatccgcggatatccacggatgc |
5705051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 42622394 - 42622345
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgc |
58 |
Q |
| |
|
|||||| |||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
42622394 |
tatccgttccgtgtccgtgacggattttatccgcggatatccacggatgc |
42622345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 7622707 - 7622751
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacg |
53 |
Q |
| |
|
||||||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
7622707 |
tatccgctccgcgtccgtggcggattttatccgcggatatccacg |
7622751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 10788880 - 10788930
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacggatgca |
59 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
10788880 |
tatccgctccgtgcccgtggcgaattttatccgcggatatccacgggtgca |
10788930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 54
Target Start/End: Complemental strand, 10408667 - 10408622
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
|||||||||||| || ||||| ||||||||| |||||||||||||| |
|
|
| T |
10408667 |
tatccgctccgtttccgtggcggattttatctgcggatatccacgg |
10408622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 54
Target Start/End: Original strand, 66943 - 66988
Alignment:
| Q |
9 |
tatccgctccgtgtctgtggctgattttatccgcggatatccacgg |
54 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||| |||| |
|
|
| T |
66943 |
tatccgctccgtgtctgtgacagattttatccacggatatctacgg |
66988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University