View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_high_2 (Length: 521)
Name: NF12535_high_2
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 470; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 470; E-Value: 0
Query Start/End: Original strand, 19 - 520
Target Start/End: Complemental strand, 30715885 - 30715384
Alignment:
| Q |
19 |
gatgaatccccataagttctgaccttaactcctcaacgggttcaatttcgtaataggcttgtaaaaacgacaacttgatttcatcccatgaaagagaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715885 |
gatgaatccccataagttctgaccttaactcctcaacgggttcaatttcgtaataggcttgtaaaaacgacaacttgatttcatcccatgaaagagaaat |
30715786 |
T |
|
| Q |
119 |
gtaataaggctcgatgttgaggtcgtaccatagtgcagattcttcttcaagtgtgacagggaagatcttcttttgcatttcaacggaggatgcattgttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715785 |
gtaataaggctcgatgttgaggtcgtaccatagtgcagattcttcttcaagtgtgacagggaagatcttcttttgcatttcaacggaggatgcattgttt |
30715686 |
T |
|
| Q |
219 |
gctctacatactttgttgaaacgactcaaatgggttattggggattcgtttggagtgccatgaaaaattggtaaaggagcgattggtatgtatgaagatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30715685 |
gctctacatactttgttgaaacgactcaaatgggttattggggattcgtttggagtgccacgaaaaattggtaaaggagcgatttgtatgtatgaagatg |
30715586 |
T |
|
| Q |
319 |
cattcatgggttgtgtgggatttgggacattataagaagaaactgaagggctttctggaacattgccaatgtgtgcttcttgtgagaaagatggtttacc |
418 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715585 |
cattcatgggttgtgtgggatttcggacattataagaagaaactgaagggctttctggaacattgccaatgtgtgcttcttgtgagaaagatggtttacc |
30715486 |
T |
|
| Q |
419 |
atgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctctttttcggtttcatcttcaaattgtctgtgctgctcc |
518 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| || ||| |
|
|
| T |
30715485 |
atgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctcttcttcggtttcatcttcaaactgtcggtgttgatcc |
30715386 |
T |
|
| Q |
519 |
tc |
520 |
Q |
| |
|
|| |
|
|
| T |
30715385 |
tc |
30715384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University