View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12535_high_20 (Length: 229)

Name: NF12535_high_20
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12535_high_20
NF12535_high_20
[»] chr2 (1 HSPs)
chr2 (57-176)||(36545006-36545124)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 57 - 176
Target Start/End: Original strand, 36545006 - 36545124
Alignment:
57 gtatcttatcaagtcttgttgtgttttatttaatagattcgtgcatcccacaagttaaaacgtcttgtttnnnnnnnnnnnnnncatatcataatgttat 156  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||  ||||||||||||||              | ||||||||||||||    
36545006 gtatcttatcaagtcttgttgtgtttt-tttaatagattcgtgcatcccacaagacaaaacgtcttgtttaaaaaaataaaaaacgtatcataatgttat 36545104  T
157 ttttcaaaaccttaaataaa 176  Q
    ||||||||||||||| ||||    
36545105 ttttcaaaaccttaattaaa 36545124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University