View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_high_22 (Length: 224)
Name: NF12535_high_22
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 44703978 - 44703764
Alignment:
| Q |
1 |
ctggttttgacgctgcctttgctatgggattcgttctcgtccttgatcaaatcaacggtgatggttcaattggtgatgatgcaactgcggagcctacggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44703978 |
ctggttttgacgctgcctttgctatgggattcgttctcgtccttgatcaaatcaacggtgatggttcaattggtgatgatgcaactgcggagcctacggt |
44703879 |
T |
|
| Q |
101 |
acaccctactacagaagaataaattactctgggttttgtttaatttaatttaacctactaatctttggagtgtccctcacgaaggggagttggatccact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44703878 |
acaccctactacagaagaataaattactctgggttttgtttaatttaatttaacctactaatctttggagtgtccctcacgaaggggagttggatccact |
44703779 |
T |
|
| Q |
201 |
actctagatctctgc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44703778 |
actctagatctctgc |
44703764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 44714681 - 44714564
Alignment:
| Q |
1 |
ctggttttgacgctgcctttgctatgggattcgttctcgtccttgatcaaatcaacggtgatggttcaattggtgatgatgcaactgcggagcctacggt |
100 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| |||||||||||||||| |||| |||||||| ||| ||| ||||||||||||||||||| || | || |
|
|
| T |
44714681 |
ctggttttgatgctgcttttgcaatgggatttattctcgtccttgatcatatcagcggtgatgattcccttgatgatgatgcaactgcggagtcttctgt |
44714582 |
T |
|
| Q |
101 |
acaccctactacagaaga |
118 |
Q |
| |
|
|| ||||| |||||||| |
|
|
| T |
44714581 |
gcatcctaccacagaaga |
44714564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University