View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_low_11 (Length: 333)
Name: NF12535_low_11
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 38 - 323
Target Start/End: Complemental strand, 785634 - 785350
Alignment:
| Q |
38 |
atgttgttgtgaggccccctagatttatcggaagatatctttcgattgtgtaannnnnnnnnnnnnnnnnactatagaaagttatctttcaatgaagtat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
785634 |
atgttgttgtgaggccccctagatttatcggaagatatctttcgattgtgtaatttttttgctcttttttactatagaaagttatctttcaatgaagtat |
785535 |
T |
 |
| Q |
138 |
ttaatttgttttaagtaacttgagagatttaatcttaacaactgcgcgtaaaagatagtctatttcttgnnnnnnntaatataaacagagtcatgccctc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
785534 |
ttaatttgttttaagtaacttgagagatt-aatcttaacaactgcgcgtaaaagatagtctatttcttgaaaaaaataatataaacagagtcatgccctc |
785436 |
T |
 |
| Q |
238 |
cactcctagtttcaattattattttggtaaatcatactctccatttatatcgacattatttgcattcccttcccctctgtgctgct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
785435 |
cactcctagtttcaattattattttggtaaatcatactctccatttatatcgacattatttgcattcccttcccctttgtgttgct |
785350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 785688 - 785652
Alignment:
| Q |
1 |
caattaggtctccaccagtgaacagtgagatatgaat |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785688 |
caattaggtctccaccagtgaacagtgagatatgaat |
785652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University