View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_low_18 (Length: 240)
Name: NF12535_low_18
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 34932978 - 34933098
Alignment:
| Q |
18 |
ggtaattagatgatgatgatgatatgtactaattaattaaacacactctatcaaaactaatataatcattccatcaaagaagagaaaatcccgaattcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932978 |
ggtaattagatgatgatgatgatatgtactaattaattaaacacactctatcaaaactaatataatcattccatcaaagaagagaaaatcccgaattcac |
34933077 |
T |
 |
| Q |
118 |
aaggtttaaaccctaaccccc |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34933078 |
aaggtttaaaccctaaccccc |
34933098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University