View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_low_21 (Length: 229)
Name: NF12535_low_21
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 57 - 176
Target Start/End: Original strand, 36545006 - 36545124
Alignment:
| Q |
57 |
gtatcttatcaagtcttgttgtgttttatttaatagattcgtgcatcccacaagttaaaacgtcttgtttnnnnnnnnnnnnnncatatcataatgttat |
156 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
36545006 |
gtatcttatcaagtcttgttgtgtttt-tttaatagattcgtgcatcccacaagacaaaacgtcttgtttaaaaaaataaaaaacgtatcataatgttat |
36545104 |
T |
|
| Q |
157 |
ttttcaaaaccttaaataaa |
176 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
36545105 |
ttttcaaaaccttaattaaa |
36545124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University